AT GC TA AT CG ATCGATCGATCGATCGATCG GCTAGCTAGCTAGCTAGCTA Met-Ala-Gly-Pro-Ser-Leu-Val-Ile TTAGGCAATCGTTACGGACC Pro-His-Trp-Cys-Gln-Arg-Lys 5'—ATCGGCTAGCTTAACGGATCCTTAG—3' 3'—TAGCCGATCGAATTGCCTAGGAATC—5' AUGCCGUACGAUUCCGGA
A decentralized foundation for life sciences

Where life, code, and community meet.

helixstreet is a decentralized autonomous organization advancing the intersection of life sciences, AI, and blockchain — so medicine, genomics, and the living world around us become more open, personal, and resilient.

Scroll
Our mission

Better biology, openly built.

Health data is fragmented, genomic insight is locked behind walls, and the species we share the planet with rarely get a seat at the table. helixstreet.foundation exists to change that — funding, governing, and stewarding projects that put people and the living world back at the center of the science.

What we focus on

Three currents, one stream.

Life sciences grounded in biology. Decentralized infrastructure that returns control to patients and researchers. AI that accelerates discovery without flattening the human story.

Life sciences

Genomics, drug development, clinical trials, and preventive care — with patient experience and biological nuance treated as first-class data.

Decentralized infrastructure

Blockchain-based records, supply-chain provenance, and community governance that replace gatekeepers with auditable, patient-owned systems.

AI & language models

Large language models applied to genomics and biomedicine — to read DNA at scale, surface disease associations, and accelerate therapies.

Working groups

Six domains where we're moving first.

Each working group is an open collective of researchers, clinicians, developers, and community members building toward a specific, concrete outcome.

01

Patient dossier

Decentralized medical records that give patients real control of their history and let care teams access current, accurate information in real time.

02

Drug production control

An immutable record of every drug's journey — reducing counterfeiting, enabling recalls, and making the pharmaceutical supply chain trustworthy by default.

03

Drug logistics

Transparent tracking of stock levels and movements across the supply chain, so shortages are caught early and inventory flows where it's needed.

04

Drug development

Blockchain-coordinated clinical trials: faster recruitment, shared data in real time, and expedited regulatory paths — without compromising patient consent.

05

Patient-centered drug rating

A secure place for patients to share experiences with specific drugs — turning individual stories into rigorous signal on efficacy and side effects.

06

Genomics

Personal genomic data, personally controlled — opening the door to research consent at the individual level and truly personalized care.

Why a foundation

A DAO with a long horizon.

helixstreet.foundation is the patient, public-good arm of the helixstreet ecosystem — set up to steward open-source infrastructure, grant research, and support the communities whose lives these tools change.

6
Active working groups
3
Continents represented in the DAO
100%
Open-source by default
Biodiversity stewarded on-chain
From the journal

Notes from the frontier.

Essays, research briefs, and community updates on where life sciences, AI, and decentralized infrastructure meet.

Essay · Nov 30, 2023

Revolutionizing life sciences with blockchain

A tour of six areas — patient dossiers, drug production, logistics, development, rating, and genomics — where decentralized infrastructure can reshape healthcare.

Read the essay →
Research brief · Nov 30, 2023

Large language models: revolutionizing genomics

How LLMs are reading DNA at scale — predicting gene function, pinpointing disease-associated variants, and accelerating the search for new therapies.

Read the brief →
Announcement · Nov 7, 2023

helixstreet & biodiversity: a BioDiversity NFT

The foundation is now the steward of a biodiversity NFT collection — images of plants and animals from around the world, preserved on-chain as a public good.

Read the announcement →

Build with us — one strand at a time.

Whether you're a scientist with an idea, a developer shipping open-source infrastructure, a clinician tired of broken systems, or a steward of the living world — helixstreet.foundation is a place to coordinate.